Molecular Biology Question - USMLE Forums
USMLE Forums Logo
USMLE Forums         Your Reliable USMLE Online Community     Members     Posts
Home
USMLE Articles
USMLE News
USMLE Polls
USMLE Books
USMLE Apps
Go Back   USMLE Forums > USMLE Step 1 Forum

USMLE Step 1 Forum USMLE Step 1 Discussion Forum: Let's talk about anything related to USMLE Step 1 exam


Reply
 
Thread Tools Search this Thread Display Modes
  #1  
Old 05-23-2012
USMLE Forums Master
 
Steps History: 1+CK+CS+3
Posts: 790
Threads: 76
Thanked 672 Times in 316 Posts
Reputation: 690
DNA Molecular Biology Question

HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA
Hemoglobin is isolated from the erythrocytes of a young child with anemia.
Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin,
known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain.The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account
for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
B. A mutation in the stop codon resulted in elongation of the b-chain
C. A point mutation resulted in the insertion of a stop codon in the b-chain
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
E. A two base pair deletion resulted in truncation of the b-chain
__________________

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Matched!!!
Reply With Quote Quick reply to this message



  #2  
Old 05-23-2012
DocSikorski's Avatar
USMLE Forums Master
 
Steps History: 1+CK+CS+3
Posts: 1,353
Threads: 94
Thanked 873 Times in 506 Posts
Reputation: 886
Default

d...................
__________________
Ambition is a dream with a V8 engine. EP
Reply With Quote Quick reply to this message
  #3  
Old 05-24-2012
USMLE Forums Addict
 
Steps History: 1+CK+CS
Posts: 196
Threads: 9
Thanked 97 Times in 64 Posts
Reputation: 107
Default

D

Sent from my Desire HD
Reply With Quote Quick reply to this message
  #4  
Old 05-24-2012
USMLE Forums Master
 
Steps History: 1+CK+CS
Posts: 1,039
Threads: 189
Thanked 557 Times in 318 Posts
Reputation: 567
Default D

D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
Reply With Quote Quick reply to this message
  #5  
Old 05-24-2012
USMLE Forums Scout
 
Steps History: Not yet
Posts: 72
Threads: 8
Thanked 11 Times in 11 Posts
Reputation: 21
Default

Hmm... can someone please give the explanation for the answer?

Feel so lost.

Thanks
Reply With Quote Quick reply to this message
  #6  
Old 05-24-2012
Rookie's Avatar
USMLE Forums Guru
 
Steps History: 1+CK+CS
Posts: 394
Threads: 40
Thanked 218 Times in 99 Posts
Reputation: 228
Default

Quote:
Originally Posted by viral View Post
Hmm... can someone please give the explanation for the answer?

Feel so lost.

Thanks
HbNI is normal heamoglobin in which after AA there is addition of two base pairs GA which leads to abnormal HbCrAAGAGU...
Hope this helped
Reply With Quote Quick reply to this message
The above post was thanked by:
Dr. Mexito (05-24-2012), viral (05-24-2012)
  #7  
Old 05-24-2012
Kabutar111's Avatar
USMLE Forums Guru
 
Steps History: Not yet
Posts: 414
Threads: 30
Thanked 86 Times in 69 Posts
Reputation: 96
Send a message via Skype™ to Kabutar111
Default

Quote:
Originally Posted by Rookie View Post
HbNI is normal heamoglobin in which after AA there is addition of two base pairs GA which leads to abnormal HbCrAAGAGU...
Hope this helped
You mean AG not GA ???
__________________
There is no shortcut to SUCCESS ,and there is no excuse for FALIURE - by Kabutar111
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Reply With Quote Quick reply to this message
  #8  
Old 05-24-2012
USMLE Forums Scout
 
Steps History: Not yet
Posts: 23
Threads: 12
Thanked 4 Times in 3 Posts
Reputation: 14
Default

A and G has been added position 3 and 5. answer is D
Reply With Quote Quick reply to this message
  #9  
Old 05-24-2012
Kabutar111's Avatar
USMLE Forums Guru
 
Steps History: Not yet
Posts: 414
Threads: 30
Thanked 86 Times in 69 Posts
Reputation: 96
Send a message via Skype™ to Kabutar111
Default

Quote:
Originally Posted by ojinaka View Post
A and G has been added position 3 and 5. answer is D
I believe the addition is at 4 & 5 position.
__________________
There is no shortcut to SUCCESS ,and there is no excuse for FALIURE - by Kabutar111
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Reply With Quote Quick reply to this message
  #10  
Old 05-24-2012
USMLE Forums Veteran
 
Steps History: 1+CK+CS
Posts: 207
Threads: 68
Thanked 84 Times in 56 Posts
Reputation: 94
Default

Quote:
Originally Posted by anomali View Post
HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA
Hemoglobin is isolated from the erythrocytes of a young child with anemia.
Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin,
known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain.The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented above. Which of the following would account
for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the b-chain
B. A mutation in the stop codon resulted in elongation of the b-chain
C. A point mutation resulted in the insertion of a stop codon in the b-chain
D. A two base pair addition resulted in the elimination of a stop codon in the b-chain
E. A two base pair deletion resulted in truncation of the b-chain
Additional AG after AAG in abnormal b-chain results in the frame shift which contributes to the elimination of a stop codon UAA.
Reply With Quote Quick reply to this message
  #11  
Old 05-24-2012
USMLE Forums Master
 
Steps History: 1+CK+CS+3
Posts: 790
Threads: 76
Thanked 672 Times in 316 Posts
Reputation: 690
Default

You guys are right .....the correct answer is D........
__________________

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Matched!!!
Reply With Quote Quick reply to this message



Reply

Tags
Molecular-Biology-, Step-1-Questions

Quick Reply
Message:
Options

Register Now

In order to be able to post messages on the USMLE Forums forums, you must first register.
Please enter your desired user name, your email address and other required details in the form below.
User Name:
Password
Please enter a password for your user account. Note that passwords are case-sensitive.
Password:
Confirm Password:
Email Address
Please enter a valid email address for yourself.
Email Address:
Medical School
Choose "---" if you don't want to tell. AMG for US & Canadian medical schools. IMG for all other medical schools.
USMLE Steps History
What steps finished! Example: 1+CK+CS+3 = Passed Step 1, Step 2 CK, Step 2 CS, and Step 3.

Choose "---" if you don't want to tell.

Favorite USMLE Books
What USMLE books you really think are useful. Leave blank if you don't want to tell.
Location
Where you live. Leave blank if you don't want to tell.

Log-in

Human Verification

In order to verify that you are a human and not a spam bot, please enter the answer into the following box below based on the instructions contained in the graphic.



Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes


Similar Threads
Thread Thread Starter Forum Replies Last Post
Cell Biology Histology & Molecular Biology references? Arma USMLE Step 1 Forum 2 04-29-2016 02:56 AM
Two Molecular Biology Doubts! Androide89 USMLE Step 1 Forum 14 07-27-2014 09:53 AM
Molecular Biology of abetalipoproteinemia; abstract based question scopusmount USMLE Step 1 Forum 2 11-11-2011 01:50 AM
Molecular Biology Q drgsarunprasath USMLE Step 1 Forum 4 08-11-2011 04:59 AM
molecular biology question usmlemydream USMLE Step 1 Forum 14 07-30-2011 08:05 AM

RSS Feed
Find Us on Facebook
vBulletin Security provided by vBSecurity v2.2.2 (Pro) - vBulletin Mods & Addons Copyright © 2017 DragonByte Technologies Ltd.

USMLE® & other trade marks belong to their respective owners, read full disclaimer
USMLE Forums created under Creative Commons 3.0 License. (2009-2014)